KeySet : "touched-1997-06-12_10:00:37_frist"
Text : "Nuclear DNA Content of Some Important Plant Species"
Text : "Two ABA-responsive proteins from pea (Pisum sativum L.) are closely related to intracellular pathogenesis-related proteins"
Text : "The root epidermis-specific pea gene RH2 is homologous to a pathogenesis-related gene"
Text : "Recommendations for naming plant pathogenesis-related proteins"
Text : "Small Cysteine-Rich Antifungal Proteins from Radish: Their Role in Host Defense"
Text : "Cloning and Sequenceing of Disease-Resistance Response Gene DRR49a (Ypr10.PS.1\; pI49) from Pisum sativum"
Text : "Plant defense multigene families II. Differential expression patterns of PR10 multigene family members diverges rapidly among Pisum species"
Text : "Plant defense multigene families. I. Divergence of Fusarium solani-induced gene expression in Pisum and Lathyrus"
Text : "Acquired Resistance in Arabidopsis"
Text : "Expression of a pea disease resistance response gene in the potato cultivar Shepody"
Text : "Cloning and characterization of a disease resistance response gene in pea inducible by Fusarium solani"
Text : "The Fusarium solani-Induced Expression of a Pea Gene Family Encoding High Cysteine Content Proteins"
Text : "Molecular characterization of disease-resistance response gene DRR206-d from Pisum sativum"
Text : "Pea genes associated with non-host resistance to fungi are also active in race-specific resistance to bacteria"
Text : "Disease Resistance Response Genes in Plants: Expression and Proposed Mechanisms of Induction"
Text : "Efficient Construction of Plant Genomic Liibraries Requires the Use of mcr- Host Strains and Packaging Mixes"
Text : "Induction of Arabidopsis Defense Genes by Virulent and Avirulent Pseudomonas syringae Strains and by a Cloned Avirulence Gene"
Text : "Genetic Analysis of Green Seed Color in Field Pea (Pisum sativum L.)"
Text : "The disease resistance response in pea is associated with increased levels of specific mRNAs"
Text : "Gene expression in susceptible and disease resistant interactions of peas induced with Fusarium solani pathogens and chitosan"
Text : "cDNA sequences for pea disease resistance response genes"
Text : "Chitosan, a natural regulator in plant-fungal pathogen interactions, increases crop yields"
Text : "Gene structure and in situ localization of pathogenesis-related protein 1 in parsley"
Text : "Chloroplast DNA variation and evolution in Pisum: Patterns of change and phylogenetic analysis"
Text : "Developmental Regulation of Cytosine Methylation in the Nuclear Ribosomal RNA Genes of Pisum sativum"
Text : "Codon usage in Brassica genes"
Text : "DNA sequence organization in the pea genome"
Text : "XI. The biosystematica and domestication of peas (Pisum L.)"
Text : "Isolation of an Characterization of a wound-induced transcript from the monocotyledon Asparagus that shares homology with a new class of pathogenesis-related (PR) proteins."
Text : "Chitin, Chitosan and Related Enzymes"
Text : "Hydrogen peroxide does not function downstream of salicylic acid in the induction of PR protein expression"
Text : "Molecular Strategies for Crop Protection"
LongText : "http:\/\/www.med.nyu.edu\/people\/S.Brown.html"
LongText : "http:\/\/home.cc.umanitoba.ca\/~frist"
LongText : "5kd Cys-rich protein"
LongText : "PR10 pathogenesis-related protein"
LongText : "ribonuclease like?"
LongText : "Perfect match to Ypr10.Pi.sat.2"
LongText : "Also amplifies with Ypr10.Pi.hum.2 and Ypr10.Pi.ful.2"
LongText : "Conserved primer for pea Drr39"
LongText : "Drr49a downstream primer"
LongText : "Has biotinylated 5' end for use in ELISA detection"
LongText : "Upstream primer specific for Pea Drr49a (a PR10 homologue)"
LongText : "base-pairs with oKR49aBOT to form an adaptor"
LongText : "Ligated to SacI site of GUS gene from pBI101"
LongText : "Adaptor pair contains internal AatII site"
LongText : "base-pairs with oKR49aTOP to form an adaptor"
LongText : "Designed by Karen Rempel set of adaptors for making construct pCC2GUS"
LongText : "Designed by Karen Rempel as a set of adaptors for making constructs pCC2GUS"
LongText : "Upstream primer specific for pea ABA-inducible gene ABR17 (a PR10 homologue)"
LongText : "Downstream primer specific for pea ABA-inducible gene ABR17 (a PR10 homologue)"
LongText : "Upstream primer specific for pea ABA-inducible gene ABR18 (a PR10 homologue)"
LongText : "Downstream primer specific for pea ABA-inducible gene ABR18 (a PR10 homologue)"
LongText : "Invitrogen TA cloning vector"
LongText : "promoterless GUS vector, pBIN19 derivative"
LongText : "Bluescript II with f1 origin in -"
LongText : "orientation, and SK polylinker"
LongText : ">>>USE AGREMENT HAS BEEN SIGNED"
LongText : ">>>WITH PBI-NRC"
LongText : "pBluescript KSm13+ with BamHI site filled-in by Klenow"
LongText : "Clontech Inc."
LongText : "35S-GUS vector, pBIN19 derivative"
LongText : "T-DNA binary vector pBIN19"
LongText : "~(NULL KEY)"
LongText : "Drr230b cDNA"
LongText : "Drr49c genomic clone"
LongText : "pI49 cDNA (SalI\/HindIII frag.) in Bluescript"
LongText : "pI176 cDNA (SalI\/HindIII frag.) in Bluescript"
LongText : "Drr230a cDNA clone"
LongText : "Rs-AFP1 cDNA for radish antifungal protein"
LongText : "in EcoRI site of pBluescriptIISK-"
LongText : ">>> USE AGREEMENT HAS BEEN SIGNED"
LongText : "WITH ZENECA SEEDS AND"
LongText : "KATHOLIEKE UNIVERSITEIT LEUVEN, BELGUIM"
LongText : "P. elatius PR10.3 PCR product"
LongText : "in TA cloning site of pCRII"
LongText : "P. humile PR10.2 PCR product"
LongText : "Drr49a genomic, 3.5kb XbaI frag."
LongText : "priming site for oS49b+4 has an A insertion (see map)"
LongText : "This insert appears to contain a Drr49c-type gene, even though it was amplified with a oS49b+4 and oC49-6"
LongText : "P. elatius PR10.2 PCR product"
LongText : "P. fulvum PR10.1 PCR product"
LongText : "P. fulvum PR10.2 PCR product"
LongText : "P.humile PR10.1 PCR product"
LongText : "Pea ABA responsive gene"
LongText : "cDNA in EcoRI site"
LongText : "PR10 homologue"
LongText : ">>>USE AGREEMENT HAS BEEN SIGNED"
LongText : ">>>WITH JOHN INNES INSTITUTE"
LongText : "WITH JOHN INNES INSTITUTE"
LongText : "Contains 141bp Sau3A1 fragment from pUC19 in the BamHI site of the PR10.4 coding region"
LongText : "pABR18-2 with 245bp AluI fragment from pUC19 inserted into the EcoRV site within the PR10.5 gene"
LongText : "Drr49c genomic subclone of protein coding region"
LongText : "p49cKS with 105bp Sau3AI fragment"
LongText : "of pUC18 inserted at BglII site"
LongText : "within PR10 CDS"
LongText : "pI49KS with concatenated Sau3AI fragment"
LongText : "inserted fragments total 495bp"
LongText : "This plasmid is used as an internal standard for RT-PCR,"
LongText : "because it generates a band that is 495bp larger than that generated from the mRNA"
LongText : "pI176KS with 341bp Sau3AI fragment"
LongText : "of pUC18 inserted in opposite orientation at BglII site"
LongText : "Drr49a genomic 424bp AluI frag."
LongText : "pKX with BamHI site destroyed by Mung Bean Nuclease digestion"
LongText : "PR10 homologue from parsley"
LongText : "cDNA"
LongText : "P.sativum PR10.3 PCR product"
LongText : "Drr49a genomic frag. XbaI frag."
LongText : "cloned into pRD400"
LongText : "Used in all AKX transgenic lines"
LongText : "Drr49a cDNA clone"
LongText : "Drr49b cDNA clone"
LongText : "Drr49c gene from pCC2"
LongText : "SalI fragment in pRD400"
LongText : "Used in all B. napus cv. Westar"
LongText : "ACC and ACC-Sal transformed lines"
LongText : "pABR17 insert recloned into the KpnI site of pMB5.5-2"
LongText : "pABR18 cDNA cloned into the KpnI site of pUC19"
Image : "peamap.gif"
Image : "PI49KSV.gif"
Image : "ARBL2SKM.gif"
Image : "p49cKS.gif"
Image : "pBI101.gif"
Image : "pBR322.gif"
Image : "pCC2.gif"
Image : "pCRII.gif"
Image : "pCRII_MCS.gif"
Image : "peB4.gif"
Image : "pflvA3.gif"
Image : "pflvB9.gif"
Image : "pFRG1.gif"
Image : "pI39.gif"
Image : "pI49.gif"
Image : "pI49KS.gif"
Image : "pI176.gif"
Image : "pI176KS.gif"
Image : "pI176KSiv.gif"
Image : "pI230.gif"
Image : "pKSm13plus.gif"
Image : "pKX.gif"
Image : "pKXB1.gif"
Image : "pPK22.gif"
Image : "pPK71-2-1.gif"
Image : "pPK71-6-2.gif"
Image : "pPK74-1.gif"
Image : "pPK74-7.gif"
Image : "pPK109-28.gif"
Image : "pDC49-4.gif"
Image : "pDC230-12.gif"
Image : "pDC206-13.gif"
Image : "pDC-chit-26.gif"
Image : "pPZ204.gif"
Image : "pRD400.gif"
UserSession : "2004-01-20_14:20:06_psgendb"
DNA : "caagaaatagtggtgagtgaa"
DNA : "gtttttagtgcaccaacagcg"
DNA : "attaagtgaagtgaitca"
DNA : "atggagaagaaatcacta"
DNA : "tttaacagttttkagtgc"
DNA : "caagaaattgtggtgacagag"
DNA : "tttgagtgcagaaacatttcc"
DNA : "ggtggtgctggaaccatcaaa"
DNA : "atcccccttagctttgtcagt"
DNA : "tgttgaaggaaacggtggccc"
DNA : "gatttcctcttcactaggaat"
DNA : "tttagttgtaatcaggat"
DNA : "ggaggtgctggaaccatcaag"
DNA : "yawtityatcatgggtgt"
DNA : "gcagcatcaccttttgtgtaa"
DNA : "cttactccaaaggttatt"
DNA : "aicagcatcacctttkgt"
DNA : "tatttmacactcagctttgciatigatcc"
DNA : "ctagttacagatgctgataac"
DNA : "catcccccttagctttgtcag"
DNA : "cgacgtca"
DNA : "gatctgacgtcgagct"
DNA : "ctcttcagtaggagcagcagc"
DNA : "gacgtcagct"
DNA : "gacgtcat"
DNA : "ggtgatcaaggaagcacaagg"
DNA : "tttggcctttgtttcatcacg"
DNA : "atgataccacctctaccgtcc"
DNA : "cttagctttgccttcctcaac"
Paper : "Nuclear DNA Content"
Paper : "Iturriaga, ABA-responsive proteins"
Paper : "Inhibitors of fungal polygalacturonases"
Paper : "Advances in Molecular Genetics of Plant-Microbe Interactions Vol. 3"
Paper : "Mylona, Root epidermis-specific pea gen RH2"
Paper : "Recommendations for naming plant pathogenesis-related proteins"
Paper : "Small Cysteine-Rich Antifungal Proteins from Radish:"
Paper : "Disease Resistance Rsponse Gene Drr49a"
Paper : "Plant defense multigene families. II."
Paper : "Plant defense multigene families. I."
Paper : "Acquired Resistance in Arabidopsis"
Paper : "Chang, Pea DRR gene in potato cv. Shepody"
Paper : "pea B-1,3-glucanase induced by F. solani and chitosan"
Paper : "Chang et al. - Pea chitinase"
Paper : "Molecular cloning and characterization of a pea chitinase gene"
Paper : "Cloning and characterization of a disease resistance response gene"
Paper : "F. solani Induced High Cysteine Proteins"
Paper : "DRR206-d from Pisum sativum"
Paper : "Pea genes associated with non-host"
Paper : "Disease Resistance Response Genes"
Paper : "Molecular Strategies for Crop Protection"
Paper : "Graham, Genomic Libraries, mcr- strains"
Paper : "Induction of Arabidopsis Defense Genes"
Paper : "Harker, Chalcone Synthase Multigene Family in Pea"
Paper : "McCallum - Genetic Analysis of Field Pea"
Paper : "Discrimination among cultivars"
Paper : "Portable microcomputer software"
Paper : "The nucleotide sequence of a new human repetitive DNA"
Paper : "The disease resistance response in pea"
Paper : "Gene expression in susceptible"
Paper : "Improving the efficiency of dot-matrix"
Paper : "Database bias"
Paper : "cDNA sequences"
Paper : "Characterization of a single copy gene"
Paper : "Nucleotide seuqence of Cab-215"
Paper : "Nucleotide sequence of Cab-8"
Paper : "Concatemer chain reaction"
Paper : "Expression of the chlorophyll a\/b protein"
Paper : "Feature Expressions"
Paper : "Chitosan, a natural regulator"
Paper : "Chitin, Chitosan and Related Enzymes"
Paper : "Sommsich, Gene structure and in-situ localization"
Paper : "Datla et al. Modified binary vectors"
Paper : "Palmer - Chloroplast DNA evolution in Pisum"
Paper : "Watson et al. - Cyosine Methylation of rRNA genes of Pisum"
Paper : "Codon usage in Brassica"
Paper : "Nomenclature for Chitinase Genes"
Paper : "Murray Pea genome"
Paper : "The phenylalanine ammonia-lyase gene family in Arabidopsis thaliana"
Paper : "Biosystematics and domestication of peas"
Paper : "Characterization of a wound-induced transcript from the monocot Asparagus"
Paper : "Hydrogen peroxide does not function downstream of salicylic acid"
Paper : "The product of the tobacco mosaic virus resistance gene N"
Paper : "GDE - Genetic Data Environment"
Paper : "Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene"
Paper : "Lr10 disease resistance locus of wheat"
Paper : "Ehmann & Schafer - chalcone synthases in mustard"
Paper : "CXc750 - pathogen induced gene"
Gene : "Ypr2.Ar.tha.M58463"
Gene : "Chs1.Ar.tha.M20308"
Gene : "Pal1.Ar.tha.L33677"
Gene : "Ypr2.Ar.tha.M90509"
Gene : "Ypr1.Ar.tha.M90508"
Gene : "Ypr5.Ar.tha.M90510"
Gene : "Ypr1.Bra.nap.1"
Gene : "Ypr1.Bra.nap.2"
Gene : "Pal1.Br.nap.1"
Gene : "Lhcb1.Br.nap.1"
Gene : "N.Br.nap.1"
Gene : "rDNA.Pi.sat"
Gene : "Drr206.Pi.sat:1"
Gene : "Drr206.Pi.sat:2"
Gene : "Chia1.Pi.sat.L37876"
Gene : "Chs1.Pi.sat.pCHS2"
Gene : "NOS.Ag.tum.1"
Gene : "35S.CaMV"
Gene : "Ypr10.Pi.sat:3"
Gene : "Drr230.Pi.sat:1"
Gene : "Drr230.Pi.sat:2"
Gene : "Ypr10.Pi.sat:2"
Gene : "Ypr10.Pi.ela.1"
Gene : "Drr230.Ra.sat:1"
Gene : "Ypr10.Pi.sat:1"
Gene : "Ypr10.Pi.sat:4"
Gene : "Ypr10.Pi.sat:5"
Gene : "Drr230.Ra.sat:2"
Gene : "Ypr10.As.off:1"
Gene : "Ypr10.Pe.cri:1"
Gene : "Ypr10.Pi.ela.3"
Gene : "Ypr10.Pi.ful.1"
Gene : "Ypr10.Pi.ful.2"
Gene : "Ypr10.Pi.ful.3"
Gene : "Ypr10.Pi.hum.1"
Gene : "Ypr10.Pi.hum.2"
Gene : "Ypr10.Pi.hum.3"
Author : "Fristensky BW"
Author : "Arumuganathan K"
Author : "Earle ED"
Author : "Iturriaga EA"
Author : "Leech MJ"
Author : "Barrat DHP"
Author : "Wang TL"
Author : "Mylona P"
Author : "Moerman M"
Author : "Yang WC"
Author : "Gloudemans T"
Author : "Van De Kerckhove J"
Author : "van Kammen A"
Author : "Bisseling T"
Author : "Franssen H"
Author : "van Loon LC"
Author : "Pierpoint WS"
Author : "Boller T"
Author : "Conejero V"
Author : "Terras FRG"
Author : "Eggermont K"
Author : "Kovaleva V"
Author : "Raikhel NV"
Author : "Osborn RW"
Author : "Kester A"
Author : "Rees SB"
Author : "Torrekens S"
Author : "Van Leuven F"
Author : "Vanderleyden J"
Author : "Cammue BPA"
Author : "Broekaert W"
Author : "Culley D"
Author : "Brown S"
Author : "Parsons MA"
Author : "Hadwiger LA"
Author : "Tewari S"
Author : "Kenyon P"
Author : "Uknes S"
Author : "Mauch-Mani B"
Author : "Moyer M"
Author : "Potter S"
Author : "Williams S"
Author : "Dincher S"
Author : "Chandler D"
Author : "Slusarenko A"
Author : "Ward E"
Author : "Ryals J"
Author : "Chang MM"
Author : "Chiang CC"
Author : "Martin MW"
Author : "Horovitz D"
Author : "Daniels CH"
Author : "Wagoner W"
Author : "Kendra D"
Author : "Daniels MJ"
Author : "Downie JA"
Author : "Osborn AE"
Author : "Graham MW"
Author : "Doherty JP"
Author : "Woodcock DM"
Author : "Dong X"
Author : "Mindrinos M"
Author : "Davis KR"
Author : "Ausubel FM"
Author : "McCallum J"
Author : "Timmerman-Vaughn G"
Author : "Frew T"
Author : "Russel A"
Author : "Riggleman RC"
Author : "Somssich IE"
Author : "Schmelzer E"
Author : "Kawalleck P"
Author : "Hahlbrock K"
Author : "Palmer JD"
Author : "Jorgensen RA"
Author : "Thompson WF"
Author : "Watson JC"
Author : "Kaufman LS"
Author : "Kumar"
Author : "Sharma J"
Author : "Murray M"
Author : "Waines JG"
Author : "Warner SAJ"
Author : "Draper J"
Author : "Zikakis JP"
Author : "Bi Y-M"
Author : "Kenton P"
Author : "Mur L"
Author : "Darby R"
Author : "Bennett AB"
Author : "Ellis THN"
Author : "Fobert P"
Author : "Glodjo A"
Author : "Hammerlindl  JK"
Author : "He D-F"
Author : "Keller W"
Author : "De Pauw M"
Author : "Lawton KA"
Author : "Linthorst HJM"
Author : "Mailer R"
Author : "Rempel K"
Author : "Robert L"
Author : "Scarth R"
Author : "Wang Y-P"
Author : "Zhang P"
Author : "Zhang Y"
Author : "Banias V"
Author : "Buell, R"
Author : "Fristensky"
Laboratory : "Broekaert"
Laboratory : "Hadwiger"
Laboratory : "Fobert NRC\/PBI"
Laboratory : "Crop & Food Research Ltd."
Laboratory : "Fristensky"
Laboratory : "Keller W"
Laboratory : "Ryals - Ciba-Geigy"
Laboratory : "Mailer"
Laboratory : "Robert L"
Laboratory : "Scarth"
Laboratory : "Wang TL"
Journal : "Plant Mol. Biol. Reporter"
Journal : "Plant Molecular Biology"
Journal : "Plant Cell"
Journal : "Plant Physiol."
Journal : "in preparation"
Journal : "unpublished"
Journal : "American Potato J"
Journal : "Molecular Plant-Microbe Interactions"
Journal : "Plant and Animal Genome V"
Journal : "Theor. Appl. Genet."
Journal : "Nucleic Acids Res."
Journal : "Gene"
Journal : "Physiol and Mol Plant Pathol"
Journal : "DNA"
Journal : "Anal Biochem"
Journal : "Planta"
Journal : "Molecular and General Genetics"
Journal : "Genetics"
Journal : "J Mol Biol"
Journal : "J Plant Biochem and Biotech"
Journal : "Biochemistry"
Journal : "Bulletin of the Torrey Botanical Club"
Journal : "Plant J"
Journal : "CELL"
Journal : "Comp. Appl. Biosci."
Journal : "Molecular and Cellular Biology"
Species : "Agrobacterium tumefaciens"
Species : "Arabidopsis thaliana"
Species : "Leptosphaeria maculans"
Species : "Cauliflower Mosaic Virus"
Species : "Phaseolus vulgaris"
Species : "Escherichia coli"
Species : "Fusarium solani"
Species : "Pisum sativum"
Species : "Raphanus sativus"
Species : "Petroselinum crispum"
Species : "Pisum elatius"
Species : "Pisum fulvum"
Species : "Pisum humile"
Species : "Brassica napus"
Species : "Lathyrus sativus"
Species : "Lathyrus tingitanus"
Species : "Lambda"
Species : "Asparagus officinalis"
Species : "m13"
Vector : "pMB5.2-2"
Vector : "pRD400"
Vector : "pBI101"
Vector : "pBI101.2"
Vector : "pBI101.3"
Vector : "pBI121"
Vector : "pBI221"
Vector : "pBIN19"
Vector : "pBluescriptKSm13+"
Vector : "pUC18"
Vector : "pUC19"
Vector : "pCRII"
Vector : "pBluescriptIISK-"
Vector : "Uni-ZAPXR"
Vector : "pBluescriptKSII"
Vector : "pUC9"
Vector : "pBluescriptSK"
Vector : "pBR322"
Vector : "pBluescriptKSm13-"
Vector : "pCR II"
Vector : "VCS-m13"
Plasmid : "pABR17"
Plasmid : "pABR18"
Plasmid : "pFRG1"
Plasmid : "pKX"
Plasmid : "phumA1"
Plasmid : "phumA2"
Plasmid : "pPK22"
Plasmid : "phumA4"
Plasmid : "phumC8"
Plasmid : "pflvA3"
Plasmid : "pflvB9"
Plasmid : "pflvB10"
Plasmid : "pPK74-7"
Plasmid : "peB4"
Plasmid : "pPK74-1"
Plasmid : "pPK109-28"
Plasmid : "pPK71-2-1"
Plasmid : "pI49KSv"
Plasmid : "pI49KS"
Plasmid : "pI176KS"
Plasmid : "pCC2"
Plasmid : "pCHS2KS"
Plasmid : "pDC-CHIT-26"
Plasmid : "pBSPR1"
Plasmid : "pBSAPR2"
Plasmid : "pBSPR5"
Plasmid : "PSKpal"
Plasmid : "pCHS3.8"
Plasmid : "pBG1"
Plasmid : "pI49"
Plasmid : "pI176"
Plasmid : "pI206"
Plasmid : "pI39"
Plasmid : "pI230"
Plasmid : "pI259"
Plasmid : "pI204"
Plasmid : "pI236"
Plasmid : "pI225"
Plasmid : "pI206KS"
Plasmid : "pPR1-1"
Plasmid : "pCPR1H1"
Plasmid : "pHA2"
Plasmid : "p49cKS"
Plasmid : "p49cKSii"
Plasmid : "pACC"
Plasmid : "pDC230-12"
Plasmid : "pI176KSiv"
Plasmid : "pPK71-6-2"
Plasmid : "pAG10-4#1"
Plasmid : "pPK64-1"
Plasmid : "pAKX"
Plasmid : "pDC49-4"
Plasmid : "pPK15-15-10"
Plasmid : "pPK16b"
Plasmid : "pKXB1"
Plasmid : "pABR17-10"
Plasmid : "pABR17-10.1"
Plasmid : "pABR18-2.20"
Plasmid : "pABR18-2"
Plasmid : "pPK74-9"
Plasmid : "pPK74-5"
Plasmid : "pRV3"
Plasmid : "pCHS2"
Plasmid : "pI204KS"
Plasmid : "pI259KS"
Plasmid : "pI225KS"
Plasmid : "pSCHS1"
Plasmid : "peB20"
Plasmid : "pPZ234-19"
Plasmid : "pPZ238-19ba"
Plasmid : "pPZ238-19pa"
Plasmid : "pPZ238-19pp"
Plasmid : "pPZ238-19eb"
Plasmid : "pPZ238-4ba"
Plasmid : "pPZ238-4eb"
Plasmid : "pPZ238-4pa"
Plasmid : "pPZ238-4pp"
Plasmid : "pDH27-11"
Plasmid : "pDH26-23"
Plasmid : "pDH26-24"
Plasmid : "pDH25-3"
Plasmid : "pDH25-11"
Plasmid : "pDH26-2"
Plasmid : "pDH25-4"
Plasmid : "pDH25-12"
Plasmid : "pDH26-4"
Plasmid : "pDH28-12"
Plasmid : "pDH26-20"
Plasmid : "pDC206-13"
Plasmid : "pPZ406-4"
Plasmid : "pPZ407-19"
Plasmid : "pfA11"
Plasmid : "pKXEcoRV"
Plasmid : "pAB96.3"
Library : "Horovitz pea genomic"
Library : "Riggleman cDNA library"
Library : "B.napus_library(Robert)"
Library : "Clontech pea"
EST : "DH25-3"
EST : "DH26-2"
EST : "DH26-20"
EST : "DH27-11"
EST : "DH28-11"
EST : "DH26-4"
EST : "DH25-4"
EST : "DH25-11"
EST : "DH25-12"
EST : "DH28-12"
Experiment : "AG3"
Experiment : "AG10"
Experiment : "AG11"
Experiment : "BF1"
Experiment : "BF3"
Experiment : "DH1"
Experiment : "PK71"
Experiment : "MD123"
Experiment : "MD7"
Experiment : "MD109"
Experiment : "KR13"
Experiment : "PK23"
Experiment : "PK74"
Experiment : "PK77"
Experiment : "PK109"
Experiment : "PK16"
Experiment : "PZ200"
Experiment : "VB1"
Experiment : "VB3"
Experiment : "AG13"
Experiment : "BF62"
Experiment : "ST303"
Experiment : "BF106"
Experiment : "KR8"
Experiment : "KR19"
Experiment : "MB9"
Experiment : "MD80"
Experiment : "MD84"
Experiment : "MD87"
Experiment : "MD88"
Experiment : "PK1"
Experiment : "PK6"
Experiment : "PK15"
Experiment : "PK124"
Experiment : "ST178"
Experiment : "ST182"
Experiment : "BF18"
Experiment : "BF49"
Experiment : "BF93"
Experiment : "BF94"
Experiment : "BF95"
Experiment : "BF96"
Experiment : "BF99"
Experiment : "BF100"
Experiment : "BF101"
Experiment : "MB5"
Experiment : "MD108"
Experiment : "MD110"
Experiment : "MD113"
Experiment : "MD114"
Experiment : "MD117"
Experiment : "MD122"
Experiment : "MD128"
Experiment : "MD142"
Experiment : "PK22"
Experiment : "PK64"
Experiment : "ST185"
Experiment : "ST221"
Experiment : "ST227"
Experiment : "ST229"
Experiment : "ST320"
Experiment : "YW2"
Experiment : "AG 10"
Experiment : "ST25"
Experiment : "BF107"
Experiment : "BF112"
DNA_Sample : "KR14.pBIA-pBIE"
DNA_Sample : "KR14.pRDA-pRDE"
DNA_Sample : "PK109-28"
DNA_Sample : "PK16 AluIb"
DNA_Sample : "VB1 eB4"
DNA_Sample : "VB1 eB20"
DNA_Sample : "VB1 fA3"
DNA_Sample : "VB1 fA11"
DNA_Sample : "VB1 fB9"
DNA_Sample : "VB1 fB10"
DNA_Sample : "AG13.pABR17-1"
DNA_Sample : "AG13.pABR17-2"
DNA_Sample : "AG13.pABR17-3"
DNA_Sample : "AG13.pABR17-4"
DNA_Sample : "AG13.pABR18-1"
DNA_Sample : "AG13.pABR18-2"
DNA_Sample : "AG13.pABR18-3"
DNA_Sample : "AG13.pABR18-4"
DNA_Sample : "BF62.pABR17"
DNA_Sample : "BF62.pABR18"
DNA_Sample : "BF106.oBF106P"
DNA_Sample : "KR8.pKX"
DNA_Sample : "KR19.pBI101.3"
DNA_Sample : "MB9.4.pABR17-10.1"
DNA_Sample : "MB9.4.pABR18-2.20"
DNA_Sample : "MD80.p49cKS"
DNA_Sample : "MD80.pUC18"
DNA_Sample : "MD84.pI49KS"
DNA_Sample : "MD84.pI176KS"
DNA_Sample : "MD87.pUC18"
DNA_Sample : "MD88.p49cKSii"
DNA_Sample : "MD88.pI49KSv"
DNA_Sample : "MD88.pI176KSiv"
DNA_Sample : "PK1C.pKX"
DNA_Sample : "PK6F_pKXEcoRV"
DNA_Sample : "PK15-5-10"
DNA_Sample : "PK124-4"
DNA_Sample : "ST178.drr49c3'(pcc2\/BamH1\/712bp)(5ng\/ul)"
DNA_Sample : "ST182.lamAX\/Bam-1.2(5ng\/ul)"
DNA_Sample : "ST182.lamAX\/Bam-1.2(100ng\/ul)"
DNA_Sample : "ST185.CHIT\/ECORI"
DNA_Sample : "ST221"
DNA_Sample : "ST227"
DNA_Sample : "ST229"
DNA_Sample : "1365.oS49b+8"
DNA_Sample : "UBC300-399"
DNA_Sample : "STRAT.Uni-ZAP"
DNA_Sample : "PK16 aluB1"
DNA_Sample : "PK23"
DNA_Sample : "PK64-3"
DNA_Sample : "PK71-2-1, hc8-1"
DNA_Sample : "PK71-4-2 Fc 9"
DNA_Sample : "PK71-6-2 Ea1"
DNA_Sample : "PK74-1"
DNA_Sample : "PK74-5"
DNA_Sample : "PK74-9"
DNA_Sample : "PK Box 1"
Linear_DNA : "pcc2\/BamH1\/712bp"
Linear_DNA : "pKX\/BamHI 1.2kb frag."
Cell_Stock : "AG3-6"
Cell_Stock : "AG10-4"
Cell_Stock : "AG11-4"
Cell_Stock : "BF1.pI39"
Cell_Stock : "BF1.pI225"
Cell_Stock : "BF3.pCC2"
Cell_Stock : "BF3.pI49KS"
Cell_Stock : "DH1.XL1-BlueMRF'"
Cell_Stock : "Elat A1"
Cell_Stock : "Hc8-1"
Cell_Stock : "ER1648"
Cell_Stock : "MD123.ER1648"
Cell_Stock : "MD7.pI39"
Cell_Stock : "MD7.pI49KS"
Cell_Stock : "MD7.pI176KS"
Cell_Stock : "MD7.pI230"
Cell_Stock : "MD7.pI204"
Cell_Stock : "MD7.pI206KS"
Cell_Stock : "MD7.pI236"
Cell_Stock : "MD7.pI225"
Cell_Stock : "MD7.pI259"
Cell_Stock : "MD109.LE392"
Cell_Stock : "pBI101"
Cell_Stock : "pRD400"
Cell_Stock : "Pk22"
Cell_Stock : "PK74-1"
Cell_Stock : "Pk74-5 Humb5"
Cell_Stock : "PK74-7"
Cell_Stock : "PK109-28"
Cell_Stock : "pPK16b"
Cell_Stock : "PZ200.XL1-blue"
Cell_Stock : "VB1 eB4"
Cell_Stock : "VB1 eB20"
Cell_Stock : "VB1 fA3"
Cell_Stock : "VB1 fA11"
Cell_Stock : "VB1 fB9"
Cell_Stock : "VB1 fB10"
Cell_Stock : "VB3.humA1"
Cell_Stock : "VB3.humA2"
Cell_Stock : "VB3.humA3"
Cell_Stock : "VB3.humA4"
Cell_Stock : "AG 10-4-1"
Cell_Stock : "AG10-4#1"
Cell_Stock : "BF.KSm13+"
Cell_Stock : "BF.KSm13-"
Cell_Stock : "BF.LE392"
Cell_Stock : "BF.pBI221"
Cell_Stock : "BF.pUC18"
Cell_Stock : "BF.pUC19"
Cell_Stock : "DH5_alpha"
Cell_Stock : "Fc 9-2"
Cell_Stock : "INV-alpha-F'"
Cell_Stock : "pFRG1"
Cell_Stock : "SB.AG3-6"
Cell_Stock : "SB.AG10-4"
Cell_Stock : "SB.AG11-4"
Cell_Stock : "SB.ATCC.38135"
Cell_Stock : "SB.ATCC.38136"
Cell_Stock : "SB.DC230"
Cell_Stock : "SB.pKX"
Cell_Stock : "SB.VE34-18"
Cell_Stock : "STRAT.GigapackGoldIII"
Cell_Stock : "STRAT.SOLR"
Cell_Stock : "STRAT.XL1-Blue_MRF'"
Cell_Stock : "BF.pAB96.3"
Phage_Stock : "MD108 Pea library"
Phage_Stock : "MD110"
Phage_Stock : "MD113-9-16"
Phage_Stock : "MD114-32-39"
Phage_Stock : "MD117(81-88)"
Phage_Stock : "MD117(24-30)"
Phage_Stock : "MD122 (>100 fractions)"
Phage_Stock : "MD128"
Phage_Stock : "MD142(1-16)"
Phage_Stock : "STRAT.ExAssist"
Phage_Stock : "STRAT.VCS-M13"
Transgenic_Line : "GN2-1#1"
Transgenic_Line : "GN2-1#2-1"
Transgenic_Line : "GN2-1#2-2"
Transgenic_Line : "GN2-1#16"
Transgenic_Line : "GN2-1#26"
Transgenic_Line : "GN2-2#11-1"
Transgenic_Line : "GN2-2#11-3"
Transgenic_Line : "GN2-2#13"
Transgenic_Line : "GN2-2#14"
Transgenic_Line : "GN2-2#15"
Transgenic_Line : "GN2-3#59"
Transgenic_Line : "GN2-4#27"
Transgenic_Line : "GN2-4#29"
Transgenic_Line : "GN2-4#30"
Transgenic_Line : "GN2-4#31"
Transgenic_Line : "GN2-4#32-1"
Transgenic_Line : "GN2-4#32-2"
Transgenic_Line : "GN2-4#66"
Transgenic_Line : "GN2-5#60"
Transgenic_Line : "GN2-5#61"
Transgenic_Line : "GN2-5#62"
Transgenic_Line : "GN2-5#63"
Transgenic_Line : "GN2-5#64"
Transgenic_Line : "GN2-5#65"
Transgenic_Line : "GN2-5#66"
Transgenic_Line : "GN2-5#67"
Transgenic_Line : "GN2-5#68"
Transgenic_Line : "GN3-1#1"
Transgenic_Line : "GN3-1#2"
Transgenic_Line : "GN3-1#3"
Transgenic_Line : "GN3-1#4-1"
Transgenic_Line : "GN3-1#4-2"
Transgenic_Line : "GN3-1#5"
Transgenic_Line : "GN3-1#6"
Transgenic_Line : "GN3-1#7"
Transgenic_Line : "GN3-1#8"
Transgenic_Line : "GN3-1#13"
Transgenic_Line : "GN3-1#16"
Transgenic_Line : "GN3-2#10"
Transgenic_Line : "GN3-2#11-1"
Transgenic_Line : "GN3-2#11-2"
Transgenic_Line : "GN3-2#14"
Transgenic_Line : "GN3-2#15-1"
Transgenic_Line : "GN3-2#15-2"
Transgenic_Line : "GN3-3#18"
Transgenic_Line : "GN3-3#20"
Transgenic_Line : "GN3-3#21"
Transgenic_Line : "GN3-4#22"
Transgenic_Line : "GN3-5#23"
Transgenic_Line : "GN3-5#24"
Transgenic_Line : "GN3-5#25"
Transgenic_Line : "GN3-5#26"
Transgenic_Line : "GN3-5#27"
Transgenic_Line : "GN3-5#28"
Transgenic_Line : "GN3-5#29"
Transgenic_Line : "GN3-5#30"
Transgenic_Line : "GN3-5#31"
Transgenic_Line : "GN3-5#32"
Transgenic_Line : "GN3-5#33"
Transgenic_Line : "GN4-2#7"
Transgenic_Line : "GN4-1#1"
Transgenic_Line : "GN4-1#3"
Transgenic_Line : "GN4-1#4"
Transgenic_Line : "GN4-1#5"
Transgenic_Line : "GN4-1#6"
Transgenic_Line : "GN4-1#7"
Transgenic_Line : "GN4-1#2"
Transgenic_Line : "GN4-1#16"
Transgenic_Line : "GN4-2#8"
Transgenic_Line : "GN4-2#9"
Transgenic_Line : "GN4-2#10-1"
Transgenic_Line : "GN4-2#11-1"
Transgenic_Line : "GN4-2#11-2"
Transgenic_Line : "GN4-2#12"
Transgenic_Line : "GN4-2#14"
Transgenic_Line : "GN4-2#15"
Transgenic_Line : "GN4-2#17"
Transgenic_Line : "GN4-2#18"
Transgenic_Line : "GN4-2#19"
Transgenic_Line : "GN4-2#21"
Transgenic_Line : "GN4-3#23"
Transgenic_Line : "GN4-4#24"
Transgenic_Line : "GN4-4#25"
Transgenic_Line : "GN4-4#27"
Transgenic_Line : "GN4-4#28"
Transgenic_Line : "GN4-4#29"
Transgenic_Line : "GN4-4#30"
Transgenic_Line : "GN4-4#31-1"
Transgenic_Line : "GN4-4#31-2"
Transgenic_Line : "AKX-6b"
Transgenic_Line : "AKX-7"
Transgenic_Line : "AKX-8"
Transgenic_Line : "AKX-9b"
Transgenic_Line : "AKX-10(3)"
Transgenic_Line : "AKX-12"
Transgenic_Line : "AKX-14"
Transgenic_Line : "AKX-26"
Transgenic_Line : "GN1-2#4"
Transgenic_Line : "GN1-2#5-1"
Transgenic_Line : "GN1-2#5-2"
Transgenic_Line : "GN1-2#7"
Transgenic_Line : "GN1-3#1-1"
Transgenic_Line : "GN1-3#1-2"
Transgenic_Line : "GN1-3#1-3"
Transgenic_Line : "GN1-4#8"
Transgenic_Line : "GN1-4#9"
Transgenic_Line : "GN1-4#10"
Transgenic_Line : "GN1-4#24"
Transgenic_Line : "GN1-4#25"
Transgenic_Line : "GN1-4#51-1"
Transgenic_Line : "GN1-4#51-2"
Transgenic_Line : "GN1-4#52"
Transgenic_Line : "GN1-4#77"
Transgenic_Line : "GN1-5#17"
Transgenic_Line : "GN1-5#18"
Transgenic_Line : "GN1-5#19"
Transgenic_Line : "GN1-5#20"
Transgenic_Line : "GN1-5#22"
Transgenic_Line : "GN1-5#23"
Transgenic_Line : "GN1-5#53-1"
Transgenic_Line : "GN1-5#54-1"
Transgenic_Line : "GN1-5#54-2"
Transgenic_Line : "GN1-5#55"
Transgenic_Line : "GN1-5#56"
Transgenic_Line : "GN1-5#72"
Transgenic_Line : "GN1-6#57"
Transgenic_Line : "GN1-6#58"
Transgenic_Line : "GN1-6#74"
Transgenic_Line : "GN1-6#75"
Transgenic_Line : "ACC1#8"
Transgenic_Line : "ACC2#24"
Transgenic_Line : "ACC2#25"
Transgenic_Line : "ACC2#27"
Transgenic_Line : "ACC2#30-1"
Transgenic_Line : "ACC2#39"
Transgenic_Line : "ACC3#37"
Transgenic_Line : "ACC4#20"
Transgenic_Line : "ACC4#21"
Transgenic_Line : "ACC4#22"
Transgenic_Line : "ACC4#23-1"
Transgenic_Line : "ACC4#23-2"
Transgenic_Line : "ACC4#34"
Transgenic_Line : "ACC4#42-1"
Transgenic_Line : "ACC4#43-1"
Transgenic_Line : "ACC4#43-2"
Transgenic_Line : "ACC4#43-3"
Transgenic_Line : "ACC5#44-1"
Transgenic_Line : "ACC5#44-2"
Transgenic_Line : "ACC5#45"
Transgenic_Line : "ACC5#46"
Transgenic_Line : "ACC5#47"
Transgenic_Line : "ACC5#48"
Transgenic_Line : "ACC5#49-1"
Transgenic_Line : "ACC5#50-1"
Transgenic_Line : "ACC5#50-2"
Transgenic_Line : "ACC1#1"
Transgenic_Line : "ACC1#2"
Transgenic_Line : "ACC1#3"
Transgenic_Line : "ACC1#4-2"
Transgenic_Line : "ACC1#6"
Transgenic_Line : "ACC1#7"
Transgenic_Line : "AKX#2"
Transgenic_Line : "AKX-4"
Transgenic_Line : "AKX#26-T2(1)"
Transgenic_Line : "AKX#26-T2(2)"
Transgenic_Line : "AKX#26-T2(3)"
Transgenic_Line : "AKX#26-T2(4)"
Transgenic_Line : "AKX#26-T2(5)"
Line : "Westar"
Line : "Glacier"
Line : "Quinta"
Isolate : "f. sp. phaseoli"
Isolate : "f. sp. pisi"
Isolate : "PG2(86-12)"
Isolate : "PG3(Lifolle6)"
Isolate : "PG4(Lifolle5)"
Oligo : "oKR49cbot"
Oligo : "oKR49ctop"
Oligo : "oS49c-5"
Oligo : "oS49c+4"
Oligo : "oC49+1"
Oligo : "oC49+3"
Oligo : "oC49-5"
Oligo : "oC49-6"
Oligo : "oC49-9"
Oligo : "oS39b+3"
Oligo : "oS39b-4"
Oligo : "oC39+1"
Oligo : "oC39+2"
Oligo : "oC39-4"
Oligo : "oS39a+3"
Oligo : "oS39a-4"
Oligo : "oS49b+4"
Oligo : "oS49b-5"
Oligo : "oS49b-7"
Oligo : "oS49b+8"
Oligo : "oS49a+4"
Oligo : "oS49a-5"
Oligo : "oS49a+8"
Oligo : "oS49a-7"
Oligo : "49e-pvr"
Oligo : "oKR49aTOP"
Oligo : "oKR49aBOT"
Oligo : "oSABR17+4"
Oligo : "oSABR17-5"
Oligo : "oSABR18+1"
Oligo : "oSABR18-5"
Oligo : "oBF106P"
Oligo : "UBC300-399"
GenBank : "p49cKS.gen"
GenBank : "PEADRRG"
GenBank : "pCC2.gen"
GenBank : "PEADRR230A"
GenBank : "PI230.gen"
GenBank : "PEADRR230B"
GenBank : "pI39.gen"
GenBank : "PEADRRA"
GenBank : "pI176.gen"
GenBank : "pI176KS.gen"
GenBank : "PI176KSIV.gen"
GenBank : "PEU57064.gen"
GenBank : "pFRG1.gen"
GenBank : "pI49KS.gen"
GenBank : "pKX.gen"
GenBank : "pKXB1.gen"
GenBank : "pPK16b.gen"
GenBank : "PSDRR1"
GenBank : "PI49KSV.gen"
GenBank : "PSABR17"
GenBank : "PSABR18"
GenBank : "PCRII.gen"
GenBank : "PEADRRB"
GenBank : "pI49.gen"
GenBank : "pCRII.dna"
Gene_Family : "Ypr10"
Gene_Family : "defensin"
